https://www.gentaur.be/shop/1137-rap-1-2nd-fwd-babesia-bovis-nested-pcr-primer-2nd-forward-100-nmol-lyophilized-14584
Babesia bovis Nested PCR primer (2nd forward) - 100 nmol (Lyophilized) | Gentaur Molecular Products
Sequence: TCAACAAGGTACTCTATATGGCTACC
babesia bovisnested pcrprimerforwardnmol
https://ibj.pasteur.ac.ir/article_740085.html
Assessing the Sensitivity of Nested PCR Followed by Direct Sequencing on Exosomal DNA for EGFR...
Background: Early and minimally invasive detection of epidermal growth factor receptor (EGFR) mutations in non-small cell lung cancer (NSCLC) patients is a...
nested pcrfollowed byassessingsensitivitydirect
https://bloodjournal.ir/article-1-119-fa.html
راهاندازی روش RT-Nested PCR به منظور تشخیص ویروس نقص ایمنی اکتسابی تیپ یک - Journal of Iranian...
چکید ه سابقه و هدف ویروس نقص ایمنی اکتسابی تیپ یک( HIV-1 ) عامل ایجاد کننده سندرم نقص ایمنی اکتسابی انسانی”ایدز” میباشد. انتقال بیماری از طریق انتقال خون در...
nested pcrjournaliranian
https://avesis.deu.edu.tr/yayin/74036933-29ec-4d86-bacc-15529ecd009e/identification-of-candida-strains-with-nested-pcr-in-bovine-mastitis-and-determination-of-antifungal-susceptibilities
Identification of Candida strains with nested PCR in bovine mastitis and determination of...
nested pcrbovine mastitisidentificationcandidastrains